|
Left Crispr |
Right Crispr |
| Crispr ID |
1072990407 |
1072990410 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
10:100186928-100186950
|
10:100186947-100186969
|
| Sequence |
CCACTTCAGATCATCAGGCATTA |
ATTAGATTCTCACAGGGAGCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 85, 1: 970, 2: 1043, 3: 594, 4: 375} |
{0: 2, 1: 4, 2: 46, 3: 90, 4: 226} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|