ID: 1072994271_1072994280

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1072994271 1072994280
Species Human (GRCh38) Human (GRCh38)
Location 10:100229479-100229501 10:100229499-100229521
Sequence CCGCATCTCCCAGGGCCCGCCCG CCGCGCCCGGCCGCAGCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 299} {0: 1, 1: 0, 2: 9, 3: 85, 4: 606}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!