ID: 1073001320_1073001325

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1073001320 1073001325
Species Human (GRCh38) Human (GRCh38)
Location 10:100288125-100288147 10:100288172-100288194
Sequence CCAGAAGCAAATGCAAAGTCCAA AGCCACCATGGAAACCCACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 254} {0: 1, 1: 0, 2: 5, 3: 48, 4: 454}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!