ID: 1073024082_1073024089

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1073024082 1073024089
Species Human (GRCh38) Human (GRCh38)
Location 10:100473583-100473605 10:100473634-100473656
Sequence CCATGTTGTAGCTTGTATCCAGT ATTCTATTATGGGTTGGACATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 16, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!