ID: 1073027052_1073027057

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1073027052 1073027057
Species Human (GRCh38) Human (GRCh38)
Location 10:100495719-100495741 10:100495749-100495771
Sequence CCATGGTTTTTGGTTTGTCTCTA GTGGAAAACCGGGATGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 41, 4: 468} {0: 1, 1: 0, 2: 30, 3: 51, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!