ID: 1073047304_1073047315

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1073047304 1073047315
Species Human (GRCh38) Human (GRCh38)
Location 10:100647257-100647279 10:100647298-100647320
Sequence CCTACTGCCCAAACTCTCACCTC CCCCTAAGGCTGTCACAGACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 292} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!