ID: 1073064464_1073064470

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1073064464 1073064470
Species Human (GRCh38) Human (GRCh38)
Location 10:100750010-100750032 10:100750027-100750049
Sequence CCAAGCCAGAGAGGGAGATCCCC ATCCCCAAAGGGGTCTGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 20, 4: 204} {0: 1, 1: 0, 2: 4, 3: 12, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!