ID: 1073095750_1073095763

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1073095750 1073095763
Species Human (GRCh38) Human (GRCh38)
Location 10:100978723-100978745 10:100978774-100978796
Sequence CCCCAAATCCCCAGGTGAGCCTG GAGGGGTCAGCCTCAGAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 239} {0: 1, 1: 1, 2: 1, 3: 25, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!