ID: 1073178097_1073178113

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1073178097 1073178113
Species Human (GRCh38) Human (GRCh38)
Location 10:101568858-101568880 10:101568901-101568923
Sequence CCTGCGGTGTTGAAAGTGGATGA GGTGATCTCAAACAAGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!