ID: 1073240409_1073240413 |
View in Genome Browser |
Spacer: 14 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1073240409 | 1073240413 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 10:102054263-102054285 | 10:102054300-102054322 |
Sequence | CCTGTAGTCACAGCTACTCAGAA | AATCGCTGGAACCCGAGAGACGG |
Strand | - | + |
Off-target summary | No data | {0: 2, 1: 57, 2: 1893, 3: 22340, 4: 81864} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |