ID: 1073240409_1073240413

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1073240409 1073240413
Species Human (GRCh38) Human (GRCh38)
Location 10:102054263-102054285 10:102054300-102054322
Sequence CCTGTAGTCACAGCTACTCAGAA AATCGCTGGAACCCGAGAGACGG
Strand - +
Off-target summary No data {0: 2, 1: 57, 2: 1893, 3: 22340, 4: 81864}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!