ID: 1073242402_1073242410

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1073242402 1073242410
Species Human (GRCh38) Human (GRCh38)
Location 10:102067010-102067032 10:102067044-102067066
Sequence CCTTCCTACAGCAGCCTGGGGTG GCCCTGCAGCTCCAGCTAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 222} {0: 1, 1: 0, 2: 1, 3: 33, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!