|
Left Crispr |
Right Crispr |
| Crispr ID |
1073257342 |
1073257347 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
10:102161438-102161460
|
10:102161463-102161485
|
| Sequence |
CCCAGGCTGATCTGAATTTCCTG |
CTCAAGCGATCCTCCTACCTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 7, 2: 298, 3: 5274, 4: 36900} |
{0: 110, 1: 3015, 2: 20458, 3: 56719, 4: 110301} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|