ID: 1073270905_1073270914

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1073270905 1073270914
Species Human (GRCh38) Human (GRCh38)
Location 10:102263111-102263133 10:102263143-102263165
Sequence CCCACACACAGTGCCGGCTCCCA TTATGGGTCAGCTGTCCCTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!