ID: 1073301521_1073301526

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1073301521 1073301526
Species Human (GRCh38) Human (GRCh38)
Location 10:102473857-102473879 10:102473891-102473913
Sequence CCTTGGTGGTCACTGACCTGGTA GGTGCTGAACCACCGCAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 136} {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!