ID: 1073306044_1073306068

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1073306044 1073306068
Species Human (GRCh38) Human (GRCh38)
Location 10:102504180-102504202 10:102504227-102504249
Sequence CCCGGCCCCACCGCGCCCCCGGC CTTCGCTTCGCTCTTTCCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 19, 3: 183, 4: 1143} {0: 1, 1: 0, 2: 0, 3: 7, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!