ID: 1073306046_1073306068

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1073306046 1073306068
Species Human (GRCh38) Human (GRCh38)
Location 10:102504185-102504207 10:102504227-102504249
Sequence CCCCACCGCGCCCCCGGCCCCTG CTTCGCTTCGCTCTTTCCCCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 122, 4: 998} {0: 1, 1: 0, 2: 0, 3: 7, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!