ID: 1073306047_1073306057

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1073306047 1073306057
Species Human (GRCh38) Human (GRCh38)
Location 10:102504186-102504208 10:102504203-102504225
Sequence CCCACCGCGCCCCCGGCCCCTGG CCCTGGCCCGACTGCCCCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 670} {0: 1, 1: 0, 2: 3, 3: 35, 4: 342}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!