ID: 1073318105_1073318109

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1073318105 1073318109
Species Human (GRCh38) Human (GRCh38)
Location 10:102597022-102597044 10:102597055-102597077
Sequence CCCATGCTCAGCACCACAAGGGC CTGTAAGAGCAGTGGCTGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 196} {0: 1, 1: 2, 2: 1, 3: 15, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!