ID: 1073325561_1073325574

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1073325561 1073325574
Species Human (GRCh38) Human (GRCh38)
Location 10:102642633-102642655 10:102642673-102642695
Sequence CCTCCGGCTGGTCCCGCGGGCCG CCTTCCTCGCGGCGGCGGCGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!