ID: 1073336509_1073336523

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1073336509 1073336523
Species Human (GRCh38) Human (GRCh38)
Location 10:102714272-102714294 10:102714310-102714332
Sequence CCATCCTCCCGCCGAGTCCCTCC TGCTGCCTCCCCCGTTACCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 489} {0: 1, 1: 0, 2: 1, 3: 10, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!