ID: 1073336510_1073336522

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1073336510 1073336522
Species Human (GRCh38) Human (GRCh38)
Location 10:102714276-102714298 10:102714309-102714331
Sequence CCTCCCGCCGAGTCCCTCCTCCT CTGCTGCCTCCCCCGTTACCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 65, 4: 736} {0: 1, 1: 0, 2: 1, 3: 15, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!