ID: 1073352848_1073352853

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1073352848 1073352853
Species Human (GRCh38) Human (GRCh38)
Location 10:102832155-102832177 10:102832186-102832208
Sequence CCTCCGCCGCCTTGGTTCAAGTG GCCTCAGCCTCCTGAGTAGCTGG
Strand - +
Off-target summary {0: 1, 1: 68, 2: 7692, 3: 45171, 4: 111929} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!