ID: 1073374482_1073374490

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1073374482 1073374490
Species Human (GRCh38) Human (GRCh38)
Location 10:103021233-103021255 10:103021255-103021277
Sequence CCCCACAGCCTCCCTGACGAAGG GAGACAGAGTGGAGAATGTAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 31, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!