ID: 1073390776_1073390779

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1073390776 1073390779
Species Human (GRCh38) Human (GRCh38)
Location 10:103174572-103174594 10:103174599-103174621
Sequence CCAGCACTCCCTCAAAAAAAGAA AAAAAAATTTTTATTAACTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 23, 3: 283, 4: 2238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!