ID: 1073420686_1073420694

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1073420686 1073420694
Species Human (GRCh38) Human (GRCh38)
Location 10:103421499-103421521 10:103421519-103421541
Sequence CCAGCCTCCTCCTCCTGAATCAG CAGTGCCTGGAGGAGCTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 82, 4: 1371} {0: 1, 1: 0, 2: 6, 3: 53, 4: 440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!