ID: 1073422200_1073422206

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1073422200 1073422206
Species Human (GRCh38) Human (GRCh38)
Location 10:103433719-103433741 10:103433755-103433777
Sequence CCCTGGAAGAGATGCACATTCTG GGTTCTGAGCTGGAGTCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 233} {0: 1, 1: 1, 2: 2, 3: 29, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!