ID: 1073422200_1073422208

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1073422200 1073422208
Species Human (GRCh38) Human (GRCh38)
Location 10:103433719-103433741 10:103433772-103433794
Sequence CCCTGGAAGAGATGCACATTCTG TGAGGGAAGCTGGTGAGAAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 70, 4: 640}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!