ID: 1073446712_1073446715

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1073446712 1073446715
Species Human (GRCh38) Human (GRCh38)
Location 10:103585262-103585284 10:103585275-103585297
Sequence CCTGGAGGCGGGGACGATCCGGG ACGATCCGGGTAGGAGACAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 128} {0: 1, 1: 0, 2: 0, 3: 6, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!