ID: 1073460100_1073460119

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1073460100 1073460119
Species Human (GRCh38) Human (GRCh38)
Location 10:103661270-103661292 10:103661314-103661336
Sequence CCAAGGACAGGCCATATAGCAAG CCGCGGGGTCCGGGGGACATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 156} {0: 1, 1: 0, 2: 1, 3: 4, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!