ID: 1073473944_1073473950

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1073473944 1073473950
Species Human (GRCh38) Human (GRCh38)
Location 10:103740822-103740844 10:103740842-103740864
Sequence CCCTTCCTTCCTTCCCTTGATCC TCCACCCAGCACTGTCTTGATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 63, 3: 915, 4: 6126} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!