ID: 1073535103_1073535111

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1073535103 1073535111
Species Human (GRCh38) Human (GRCh38)
Location 10:104269217-104269239 10:104269248-104269270
Sequence CCGGTTGCCCGAGTTCCCGGAGG GGGACCTCTCTCACCGCCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 68} {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!