ID: 1073559583_1073559588

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1073559583 1073559588
Species Human (GRCh38) Human (GRCh38)
Location 10:104485475-104485497 10:104485528-104485550
Sequence CCCTGAGGCAGAGGCTGTGTCTT GATCAGTGCCTGGCATAAAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 14, 3: 109, 4: 518}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!