ID: 1073577855_1073577860

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1073577855 1073577860
Species Human (GRCh38) Human (GRCh38)
Location 10:104640614-104640636 10:104640633-104640655
Sequence CCGGGAGCCGGCCGGGCCAGGGA GGGAGCGGCGAGCAGAGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 311} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!