ID: 1073578406_1073578417

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1073578406 1073578417
Species Human (GRCh38) Human (GRCh38)
Location 10:104642885-104642907 10:104642935-104642957
Sequence CCGAACTGGGCGCCCGACTGAGC CCCGCAGCGCGTGCCCGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 109} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!