ID: 1073716562_1073716565

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1073716562 1073716565
Species Human (GRCh38) Human (GRCh38)
Location 10:106114756-106114778 10:106114781-106114803
Sequence CCGGTAGCTGCTCTGCTGGATGC CCTAAGACTACCAAGTCCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 19, 3: 28, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!