ID: 1073767189_1073767195

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1073767189 1073767195
Species Human (GRCh38) Human (GRCh38)
Location 10:106695603-106695625 10:106695648-106695670
Sequence CCTCATAATGTATGTACTGAATG ACACCATGCCTGGCATAAAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 66, 4: 506}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!