ID: 1073784275_1073784280

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1073784275 1073784280
Species Human (GRCh38) Human (GRCh38)
Location 10:106871497-106871519 10:106871548-106871570
Sequence CCCACCAACTACAGACTGGATAA ATGCTATACAGCCATCAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 48, 3: 930, 4: 5889} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!