ID: 1073799516_1073799523

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1073799516 1073799523
Species Human (GRCh38) Human (GRCh38)
Location 10:107026064-107026086 10:107026080-107026102
Sequence CCCCCCACACACATCAAAAGGAA AAAGGAAATCACAGGCATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 379} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!