ID: 1073869770_1073869777 |
View in Genome Browser |
Spacer: 18 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1073869770 | 1073869777 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 10:107849895-107849917 | 10:107849936-107849958 |
Sequence | CCAACCTCTACTGATCCATCAGA | TCTCATAAAATTAGTTAGGGAGG |
Strand | - | + |
Off-target summary | No data | {0: 5, 1: 257, 2: 8963, 3: 4474, 4: 2446} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |