ID: 1074001405_1074001410

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1074001405 1074001410
Species Human (GRCh38) Human (GRCh38)
Location 10:109377273-109377295 10:109377307-109377329
Sequence CCTTTTGTTCCAAATGTTTTTTT GCACCTTGAAGGTGATATGTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 129, 4: 1257} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!