ID: 1074073546_1074073556

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1074073546 1074073556
Species Human (GRCh38) Human (GRCh38)
Location 10:110098776-110098798 10:110098820-110098842
Sequence CCTACCACCACGCCCAACTAATT GGGGTTTCACTATGTTGGCCAGG
Strand - +
Off-target summary {0: 137, 1: 4885, 2: 27615, 3: 64004, 4: 83324} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!