ID: 1074073546_1074073557

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1074073546 1074073557
Species Human (GRCh38) Human (GRCh38)
Location 10:110098776-110098798 10:110098824-110098846
Sequence CCTACCACCACGCCCAACTAATT TTTCACTATGTTGGCCAGGCTGG
Strand - +
Off-target summary {0: 137, 1: 4885, 2: 27615, 3: 64004, 4: 83324} {0: 8986, 1: 103834, 2: 178729, 3: 238015, 4: 254109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!