ID: 1074073547_1074073554

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1074073547 1074073554
Species Human (GRCh38) Human (GRCh38)
Location 10:110098780-110098802 10:110098801-110098823
Sequence CCACCACGCCCAACTAATTTTTT TTGTATTTTCAGTAAAGGCGGGG
Strand - +
Off-target summary {0: 327, 1: 15581, 2: 81421, 3: 175401, 4: 197227} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!