ID: 1074121673_1074121686

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1074121673 1074121686
Species Human (GRCh38) Human (GRCh38)
Location 10:110498061-110498083 10:110498095-110498117
Sequence CCTGGCCGTGGGCACCCGCGGGG GGGCCGCTGGCCGGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 37, 4: 273} {0: 1, 1: 0, 2: 5, 3: 80, 4: 1036}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!