ID: 1074121675_1074121684

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1074121675 1074121684
Species Human (GRCh38) Human (GRCh38)
Location 10:110498066-110498088 10:110498089-110498111
Sequence CCGTGGGCACCCGCGGGGCGCGC GGCGCGGGGCCGCTGGCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 120} {0: 1, 1: 0, 2: 4, 3: 58, 4: 455}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!