ID: 1074154866_1074154872

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1074154866 1074154872
Species Human (GRCh38) Human (GRCh38)
Location 10:110789262-110789284 10:110789304-110789326
Sequence CCGAACTGCCACAAAATCTAAAA CCACTGCCACCAAGCCCTTCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!