ID: 1074233229_1074233234

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1074233229 1074233234
Species Human (GRCh38) Human (GRCh38)
Location 10:111558598-111558620 10:111558651-111558673
Sequence CCGTAACTTGAAGAAACAACAGG GATACTTATTTTTAGCTGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 20, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!