ID: 1074248052_1074248058

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1074248052 1074248058
Species Human (GRCh38) Human (GRCh38)
Location 10:111714178-111714200 10:111714208-111714230
Sequence CCAAGAGTGCAGAGAGATGACTG ATTTGCAGCTGCACCCAGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 23, 3: 74, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!