ID: 1074252029_1074252038

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1074252029 1074252038
Species Human (GRCh38) Human (GRCh38)
Location 10:111760677-111760699 10:111760729-111760751
Sequence CCCATTCCAGTGAGCCATGTACA ACTCTGTCCTCCAGGAAGCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 47, 4: 449}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!