ID: 1074290093_1074290098

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1074290093 1074290098
Species Human (GRCh38) Human (GRCh38)
Location 10:112131844-112131866 10:112131860-112131882
Sequence CCCCGCATTTGACCCTCTCTACA CTCTACAGCCTCTTCCCGTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 7, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!